Homology with vesicle fusion mediator syntaxin-1a predicts determinants ofepimorphin/syntaxin-2 function in mammary epithelial morphogenesis Page: 3 of 19
This article is part of the collection entitled: Office of Scientific & Technical Information Technical Reports and was provided to UNT Digital Library by the UNT Libraries Government Documents Department.
Extracted Text
The following text was automatically extracted from the image on this page using optical character recognition software:
and Taq DNA Polymerase were from Sigma.
Purified oligonucleotides used for
mutagenesis and polymerase chain reaction
were from Bio-Synthesis (Lewisville, TX).
Deoxynucleotide triphosphates and
epidermal growth factor were from Roche
Applied Science (Indianapolis, IN).
Professor Frederick M. Hughson
(Department of Molecular Biology,
Princeton University) provided samples of
syntaxin-la protein lacking the
transmembrane domain.
Three-dimensional homology
modeling. Homology modeling was carried
out using the SWISS-MODEL/PROMOD II
server using the "first approach mode" (25).
In brief, the amino acid sequence of
syntaxin-2 was submitted to the server, and
suitable templates with a sequence identity of
more than 25% were selected. Five template
structure coordinates (1dn1B.pdb, lez3B.pdb,
lez3C.pdb, lex3A.pdb, lbr0A.pdb) were
superimposed and a structural and local pair-
wise alignment of the target sequence to the
main template structures was generated. The
positions of the backbone atoms of the
template structure were averaged and the best
loops selected using a method that accounts
for force field energy, steric hindrance and
favorable interactions. Starting with
conserved residues, the model side chains
were built by isosteric replacement of
template structure side chains. Deviations in
the model were energy minimized using the
GROMOS96 force field.
Generation of Recombinant
epimorphin. Expression constructs were
generated by PCR amplification using cDNA
for mouse epimorphin or human syntaxin-1
as template. Habc-EPM lacks the N-terminal
26 amino acids, the linker, SNARE helix,
and transmembrane domains, and was PCR-
amplified with oligonucleotides: HSHisF,
CCGCGCCATATGCACCATCACCATCA
CCATGGCGGGGATCATTTCATGGACG
GTTTCTTCCAT,HSHisR,
CGCGCGAAGCTTTTATTATTTGCTTCG
CTCCCGGAACAGGAT.
Recombinant syntaxin-la (Habc-la)
is derived from the homologous three-helix
bundle domain of syntaxin-la and was PCR-
amplified using oligonucleotides: HS1AHis,
CCGCGCCATATGCACCATCACCATCA
CCATGGCGGGGACCGCTTCATGGATG
AGTTCTTTGAA
HS 1AHisR,
CGCGCGAAGCTTTTATTATTTGCAGCG
TTCTCGGTAGTCTGA.
Both Habc-EPM and 3-Hlx-lA were
cloned as Nde 1 and HindIII fragments into a
pET-27b(+) (Novagen, San Diego, CA)
expression vector leading to a N-terminal
fusion of His6 tag to the protein fragment.
Recombinant Habc-1 -2 is derived from
Habc-1A with the proposed ligand binding
site residues mutated using the
QuickChangeTm site-directed mutagenesis kit
from Stratagene. All mutations were
introduced by polymerase chain reaction
amplification of the entire expression
plasmid using two mutated oligonucleotide
primers. Two complementary primers
carrying the mutation were used for the
substitution mutations. The sequences of the
sense primers used for the substitution of the
amino acids indicated were the following,
with the modified codons underlined and the
nucleotide changed indicated in bold:
to create the 142 protein:
M79N: 5'-
AGGAACTGGAGGAGCTCAACTCGGAC
ATTAAGAAGACAG-3'
E101D: 5'-
CGAGCAGAGCATCGACCAGGAGGAA
GGTC-3'
C145S: 5'-
GACTACCGAGAACGCAGCAAATAATA
AAAGCTTGCGG-3'
Y141F:
5'CCACTCAGTCAGACTTCCGAGAACG
CAGC-3'
Upcoming Pages
Here’s what’s next.
Search Inside
This article can be searched. Note: Results may vary based on the legibility of text within the document.
Tools / Downloads
Get a copy of this page or view the extracted text.
Citing and Sharing
Basic information for referencing this web page. We also provide extended guidance on usage rights, references, copying or embedding.
Reference the current page of this Article.
Chen, Connie S.; Nelson, Celeste M.; Khauv, Davitte; Bennett, Simone; Radisky, Evette S.; Hirai, Yohei et al. Homology with vesicle fusion mediator syntaxin-1a predicts determinants ofepimorphin/syntaxin-2 function in mammary epithelial morphogenesis, article, June 3, 2009; Berkeley, California. (https://digital.library.unt.edu/ark:/67531/metadc929835/m1/3/: accessed April 17, 2024), University of North Texas Libraries, UNT Digital Library, https://digital.library.unt.edu; crediting UNT Libraries Government Documents Department.