FLP-mediated conditional loss of an essential gene to facilitate complementation assays Page: 41
View a full description of this thesis.
Extracted Text
The following text was automatically extracted from the image on this page using optical character recognition software:
AATTCATC) and FLPmutF736 (GATGAATTTTTGAGGAACTCTGAACCAGTC) containing
a 30 bp overlap region were designed to mutate an EcoRI site in the FLP gene cassette, for
convenience in cloning. The amplification products from the first and second PCR reactions
were column purified using the Wizard SV Gel and PCR clean-up system and used as templates
in a final PCR amplification step. The final round of PCR amplified the entire FLP cassette with
the modifications incorporated in the first and second PCRs, using phosphorylated primers
FLPNcoIF1 and FLPBamR1272. The cycling conditions for the final PCR amplification are
shown in Table 9. 5 l of the final amplification product was resolved on a 1% agarose gel
confirming a 1.2 Kb FLP PCR product. In order to sequence analyze the FLP cassette for
incorporation of desired modifications, the column purified FLP PCR product was digested with
BamHI/NcoI and ligated into the BamHI/NcoI digested pADH-MCS #6 vector (B.G.Ayre;
unpublished), generating the plasmid pADH-FLP. The ligation reaction was transformed into E
.coli by heat shock and transformed cells were selected on LB media with 50 ag/mL ampicillin.
Plasmid DNA was isolated and a restriction analysis with BamHI/NcoI identified positive clones
with the BamHI and NcoI restriction sites incorporated. Sequence analysis of the FLP cassette in
pADH-MCS #6 backbone confirmed the mutation of EcoRI restriction site and the correct
sequence of the entire cassette, including introduction of NcoI and BamHI restriction sites for
cloning purpose.
The modified FLP cassette was obtained as an NcoI/BamHI fragment from the pADH-
FLP plasmid and ligated into the NcoI/BgllI digested pCAM-EASE backbone, generating the
plasmid pCAM-EASE-FLP. The ligation product was dialyzed and transformed into E. coli cells
by electroporation. Positive clones were identified by restriction analysis.41
Upcoming Pages
Here’s what’s next.
Search Inside
This thesis can be searched. Note: Results may vary based on the legibility of text within the document.
Tools / Downloads
Get a copy of this page or view the extracted text.
Citing and Sharing
Basic information for referencing this web page. We also provide extended guidance on usage rights, references, copying or embedding.
Reference the current page of this Thesis.
Ganesan, Savita. FLP-mediated conditional loss of an essential gene to facilitate complementation assays, thesis, December 2007; Denton, Texas. (https://digital.library.unt.edu/ark:/67531/metadc5180/m1/51/: accessed April 23, 2024), University of North Texas Libraries, UNT Digital Library, https://digital.library.unt.edu; .