FLP-mediated conditional loss of an essential gene to facilitate complementation assays Page: 38
View a full description of this thesis.
Extracted Text
The following text was automatically extracted from the image on this page using optical character recognition software:
each product was used as template in a single PCR amplification with primers attB 1BglF1 and
35S-45NcoIR2, and Phusion polymerase (NEB). The PCR reaction conditions for the synthetic
fragment amplification are listed in Table 7.
The synthetic fragment PCR product was digested with NcoI/Bglll and ligated into the
NcoI/BclI digested pCAMBIAO390 as the vector backbone, creating the plasmid pCAM-EASE.
The BclI and BglII sites were destroyed after ligation. The ligation product was dialysed and
transformed into E. coli cells by electroporation. Positive clones were identified by restriction
analysis. Sequence analysis was done to confirm the sequence of the synthetic fragment. This
cloning step deleted the left border of pCAMBIAO390.
3.10.2 Construction of pCAM-EASE-FLP
The FLP gene cassette (- 1.2 Kb) was amplified from HSP-FLP plasmid (Kilby et al.,
1995) using an overlap PCR approach to amplify the cDNA and remove an internal EcoRI site
(Sambrook et al., 2001). Fig. 14 shows the primer binding sites for amplification of the FLP gene
from HSP-FLP. Fig. 15 is a schematic representation of the overlap PCR approach. The first
PCR amplification was done using the primer set FLPNcoIF1 and FLPmutR766, and the second
PCR amplification was done with the primer set FLPmutF736 and FLPBamR1272, in two
separate PCR reactions using Phusion polymerase (NEB). Table 8 shows the cycling conditions
for the first and second PCR amplification rounds. The primers FLPNcoIF1 (AGTCTCCCATG-
GCTATGCCACAATTTGGTATATTATGTAAAACACC) and FLPBamR1272 (AGACTTGG-
ATCCTTATATGCGTCTATTTATGTAGGATGAAAGG) were designed to create 5'- NcoI and
3'- BamHI sites in the amplified product, respectively, for cloning into the NcoI/Bgll sites of
pCAM-EASE as backbone. The primers FLPmutR766 (GGACTGGTTCAGAGTTCCTCAAA-38
Upcoming Pages
Here’s what’s next.
Search Inside
This thesis can be searched. Note: Results may vary based on the legibility of text within the document.
Tools / Downloads
Get a copy of this page or view the extracted text.
Citing and Sharing
Basic information for referencing this web page. We also provide extended guidance on usage rights, references, copying or embedding.
Reference the current page of this Thesis.
Ganesan, Savita. FLP-mediated conditional loss of an essential gene to facilitate complementation assays, thesis, December 2007; Denton, Texas. (https://digital.library.unt.edu/ark:/67531/metadc5180/m1/48/: accessed April 19, 2024), University of North Texas Libraries, UNT Digital Library, https://digital.library.unt.edu; .